Review



sgrna targeting cdc20  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Addgene inc sgrna targeting cdc20
    Sgrna Targeting Cdc20, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+cdc20/pFL+MCC+SBP-BubR1+%2F+Cdc20+%2F+6his-Mad2+%2F+Bub3+(%233965)+(Plasmid+%23106677)/pmc09232687__13238_2021_887_MOESM1_ESM-55-8-23
    Average 92 stars, based on 5 article reviews
    sgrna targeting cdc20 - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Hyperthermia differentially affects specific human stem cells and their differentiated derivatives
    Article Snippet: .. To construct CRISPR/Cas9-mediated gene knockdown lentiviral vectors, the sgRNA targeting CDC20 (corresponding sgRNA oligonucleotide: TTCCCTGCCAGACCGTATCC) was inserted into the cloning site of lentiCRISPRv2 (Addgene, #52961). ..

    CRISPR:

    Article Title: Hyperthermia differentially affects specific human stem cells and their differentiated derivatives
    Article Snippet: .. To construct CRISPR/Cas9-mediated gene knockdown lentiviral vectors, the sgRNA targeting CDC20 (corresponding sgRNA oligonucleotide: TTCCCTGCCAGACCGTATCC) was inserted into the cloning site of lentiCRISPRv2 (Addgene, #52961). ..

    Knockdown:

    Article Title: Hyperthermia differentially affects specific human stem cells and their differentiated derivatives
    Article Snippet: .. To construct CRISPR/Cas9-mediated gene knockdown lentiviral vectors, the sgRNA targeting CDC20 (corresponding sgRNA oligonucleotide: TTCCCTGCCAGACCGTATCC) was inserted into the cloning site of lentiCRISPRv2 (Addgene, #52961). ..

    Cloning:

    Article Title: Hyperthermia differentially affects specific human stem cells and their differentiated derivatives
    Article Snippet: .. To construct CRISPR/Cas9-mediated gene knockdown lentiviral vectors, the sgRNA targeting CDC20 (corresponding sgRNA oligonucleotide: TTCCCTGCCAGACCGTATCC) was inserted into the cloning site of lentiCRISPRv2 (Addgene, #52961). ..



    Similar Products

    92
    Addgene inc sgrna targeting cdc20
    Sgrna Targeting Cdc20, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+cdc20/pFL+MCC+SBP-BubR1+%2F+Cdc20+%2F+6his-Mad2+%2F+Bub3+(%233965)+(Plasmid+%23106677)/pmc09232687__13238_2021_887_MOESM1_ESM-55-8-23
    Average 92 stars, based on 1 article reviews
    sgrna targeting cdc20 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    Image Search Results